Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr6776

expand all nodes | collapse all nodes | view schema

Name Class

Expr6776Expression_ofGeneWBGene00001005
Reflects_endogenous_expression_ofWBGene00001005
HomolHomol_homolT26A5:Expr
Expression_data (2)
TypeReporter_gene[dlc-1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CACTTTGTGATCGTCGGATTTA] 3' and primer B 5' [ATTTTGAACGGATTTGGCTG] 3'.
PatternAdult Expression: pharynx; intestine - posterior cells; Nervous System; ventral nerve cord; head neurons; tail neurons;
Larval Expression: pharynx; intestine - posterior cells; body wall muscle; Nervous System; ventral nerve cord; head neurons; tail neurons;
RemarkAlso expressed in (comments from author) : Embryo incomplete. To be updated.
Strain: BC10571
ReferenceWBPaper00006525
TransgeneWBTransgene00002318