WormBase Tree Display for Expr_pattern: Expr6784
expand all nodes | collapse all nodes | view schema
Expr6784 | Expression_of | Gene | WBGene00012074 | ||
---|---|---|---|---|---|
Reflects_endogenous_expression_of | WBGene00012074 | ||||
Homol | Homol_homol | T27A8:Expr | |||
Expression_data | Life_stage | WBls:0000041 | |||
Anatomy_term | WBbt:0005735 | ||||
WBbt:0005741 | Partial | ||||
Remark | unidentified cells | ||||
WBbt:0006759 | |||||
Type | Reporter_gene | [T27A8.2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTTGACGGAGAAGGCTGG] 3' and primer B 5' [ATACGTGATGGTAGCTGAAAATGA] 3'. | |||
Pattern | Adult Expression: Nervous System; tail neurons; unidentified cells in tail ; | ||||
Picture | WBPicture0000006494 | ||||
Remark | Also expressed in (comments from author) : Unsure if expression is in the larval stage. Only detected GFP in adult tails.Looked at the strain a year later, and saw no expression. | ||||
Strain: BC11868 | |||||
Reference | WBPaper00006525 | ||||
Transgene | WBTransgene00002728 |