Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr6827

expand all nodes | collapse all nodes | view schema

Name Class

Expr6827Expression_of (2)
HomolHomol_homolW02D7:Expr
Expression_dataLife_stageWBls:0000041
WBls:0000023
Anatomy_term (23)
TypeReporter_gene[sel-9::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTTGATGCATTGGCATGACT] 3' and primer B 5' [ATGTCAGCGAATTGATTTTGTTAG] 3'.
PatternAdult Expression: pharynx; pharyngeal gland cells; intestine; anal depressor muscle; rectal epithelium; Reproductive System; distal tip cell; vulva other; spermatheca; gonad sheath cells; body wall muscle; hypodermis; seam cells; excretory cell; excretory gland cells; coelomocytes; Nervous System; nerve ring; head neurons; neurons along body; tail neurons; unidentified cells;
Larval Expression: pharynx; pharyngeal gland cells; intestine; anal depressor muscle; rectal epithelium; Reproductive System; distal tip cell; developing vulva; developing uterus; body wall muscle; hypodermis; seam cells; excretory cell; excretory gland cells; coelomocytes; Nervous System; nerve ring; head neurons; neurons along body; tail neurons; unidentified cells;
RemarkStrain: BC11847
ReferenceWBPaper00006525
TransgeneWBTransgene00002716