WormBase Tree Display for Expr_pattern: Expr6858
expand all nodes | collapse all nodes | view schema
Expr6858 | Expression_of | Gene | WBGene00012348 |
---|---|---|---|
Reflects_endogenous_expression_of | WBGene00012348 | ||
Homol | Homol_homol | W08G11:Expr | |
Expression_data | Life_stage | WBls:0000041 | |
WBls:0000023 | |||
Anatomy_term (16) | |||
Type | Reporter_gene | [W08G11.4::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GCGTCTCGTCTTGTTTCTACAGT] 3' and primer B 5' [CCGCTTCCGTGGATTTTT] 3'. | |
Pattern | Adult Expression: pharynx; intestine; body wall muscle; excretory cell; Nervous System; nerve ring; ventral nerve cord; head neurons; neurons along body; tail neurons; phasmids; unidentified cells in head; unidentified cells in tail ; | ||
Larval Expression: pharynx; intestine; Reproductive System; distal tip cell; body wall muscle; excretory cell; Nervous System; nerve ring; ventral nerve cord; head neurons; neurons along body; tail neurons; phasmids; unidentified cells in head; unidentified cells in tail ; | |||
Remark | Also expressed in (comments from author) : Mosaic population.Embryo incomplete. To be updated. | ||
Strain: BC14613 | |||
Reference | WBPaper00006525 | ||
Transgene | WBTransgene00003625 |