Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr6858

expand all nodes | collapse all nodes | view schema

Name Class

Expr6858Expression_ofGeneWBGene00012348
Reflects_endogenous_expression_ofWBGene00012348
HomolHomol_homolW08G11:Expr
Expression_dataLife_stageWBls:0000041
WBls:0000023
Anatomy_term (16)
TypeReporter_gene[W08G11.4::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GCGTCTCGTCTTGTTTCTACAGT] 3' and primer B 5' [CCGCTTCCGTGGATTTTT] 3'.
PatternAdult Expression: pharynx; intestine; body wall muscle; excretory cell; Nervous System; nerve ring; ventral nerve cord; head neurons; neurons along body; tail neurons; phasmids; unidentified cells in head; unidentified cells in tail ;
Larval Expression: pharynx; intestine; Reproductive System; distal tip cell; body wall muscle; excretory cell; Nervous System; nerve ring; ventral nerve cord; head neurons; neurons along body; tail neurons; phasmids; unidentified cells in head; unidentified cells in tail ;
RemarkAlso expressed in (comments from author) : Mosaic population.Embryo incomplete. To be updated.
Strain: BC14613
ReferenceWBPaper00006525
TransgeneWBTransgene00003625