Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr6864

expand all nodes | collapse all nodes | view schema

Name Class

Expr6864Expression_ofGeneWBGene00012366
Reflects_endogenous_expression_ofWBGene00012366
HomolHomol_homolW09G3:Expr
Expression_dataLife_stageWBls:0000041
WBls:0000023
Anatomy_term (16)
TypeReporter_gene[W09G3.2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTGTAATTTGTACATTTTCCGGG] 3' and primer B 5' [TCCATCATGATCATTTGTAGTTTT] 3'.
PatternAdult Expression: pharynx; pharyngeal gland cells; anal depressor muscle; rectal epithelium; Reproductive System; vulva other; body wall muscle; hypodermis; seam cells; coelomocytes; Nervous System; nerve ring; ventral nerve cord; head neurons; neurons along body; tail neurons;
Larval Expression: pharynx; pharyngeal gland cells; anal depressor muscle; rectal epithelium; Reproductive System; developing vulva; body wall muscle; hypodermis; seam cells; Nervous System; nerve ring; ventral nerve cord; head neurons; neurons along body; tail neurons;
Picture (6)
RemarkAlso expressed in (comments from author) : No comments.
Strain: BC15517
ReferenceWBPaper00006525
TransgeneWBTransgene00004002