WormBase Tree Display for Expr_pattern: Expr6888
expand all nodes | collapse all nodes | view schema
Expr6888 | Expression_of | Gene | WBGene00013766 |
---|---|---|---|
Reflects_endogenous_expression_of | WBGene00013766 | ||
Homol | Homol_homol | Y113G7B:Expr | |
Expression_data | Life_stage | WBls:0000041 | |
WBls:0000023 | |||
Anatomy_term | WBbt:0003681 | ||
WBbt:0005300 | |||
WBbt:0005733 | |||
WBbt:0005735 | |||
WBbt:0005747 | |||
WBbt:0005772 | |||
WBbt:0005813 | |||
WBbt:0005821 | |||
WBbt:0006749 | |||
WBbt:0006751 | |||
WBbt:0006759 | |||
Type | Reporter_gene | [Y113G7B.17::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GGCAAGTCGTCTGACATGATT] 3' and primer B 5' [CCCGCTGGAAAAAGGTTAAT] 3'. | |
Pattern | Adult Expression: pharynx; intestine; Reproductive System; vulval muscle; body wall muscle; hypodermis; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons; | ||
Larval Expression: pharynx; intestine; body wall muscle; hypodermis; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons; | |||
Remark | Also expressed in (comments from author) : L1s have high intensity GFP, later stages progressively lose intensity | ||
Strain: BC13727 | |||
Reference | WBPaper00006525 | ||
Transgene | WBTransgene00003267 |