Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr6888

expand all nodes | collapse all nodes | view schema

Name Class

Expr6888Expression_of (2)
HomolHomol_homolY113G7B:Expr
Expression_dataLife_stageWBls:0000041
WBls:0000023
Anatomy_term (11)
TypeReporter_gene[Y113G7B.17::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GGCAAGTCGTCTGACATGATT] 3' and primer B 5' [CCCGCTGGAAAAAGGTTAAT] 3'.
PatternAdult Expression: pharynx; intestine; Reproductive System; vulval muscle; body wall muscle; hypodermis; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons;
Larval Expression: pharynx; intestine; body wall muscle; hypodermis; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons;
RemarkAlso expressed in (comments from author) : L1s have high intensity GFP, later stages progressively lose intensity
Strain: BC13727
ReferenceWBPaper00006525
TransgeneWBTransgene00003267