WormBase Tree Display for Expr_pattern: Expr6889

Expr6889 Expression_of: Gene: WBGene00013766
    Reflects_endogenous_expression_of: WBGene00013766
  Homol: Homol_homol: Y113G7B:Expr
  Expression_data: Life_stage: WBls:0000041
      WBls:0000023
    Anatomy_term: WBbt:0003681
      WBbt:0004292
      WBbt:0005739 Partial
        Remark: unidentified cells
      WBbt:0005772
  Type: Reporter_gene: [Y113G7B.17::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GGCAAGTCGTCTGACATGATT] 3' and primer B 5' [AGTCGACCTGCAGGCATGCAAGCT CCCGCTGGAAAAAGGTTAAT] 3'.
  Pattern: Adult Expression: pharynx; anal depressor muscle; unidentified cells in head;
    Larval Expression: pharynx; intestine; unidentified cells in head;
  Remark: Also expressed in (comments from author) : Mosaic population.Embryo incomplete. To be updated.Strain not available.
    Strain: BC10240
  Reference: WBPaper00006525
  Transgene: WBTransgene00002150