WormBase Tree Display for Expr_pattern: Expr6889
expand all nodes | collapse all nodes | view schema
Expr6889 | Expression_of | Gene | WBGene00013766 | ||
---|---|---|---|---|---|
Reflects_endogenous_expression_of | WBGene00013766 | ||||
Homol | Homol_homol | Y113G7B:Expr | |||
Expression_data | Life_stage | WBls:0000041 | |||
WBls:0000023 | |||||
Anatomy_term | WBbt:0003681 | ||||
WBbt:0004292 | |||||
WBbt:0005739 | Partial | ||||
Remark | unidentified cells | ||||
WBbt:0005772 | |||||
Type | Reporter_gene | [Y113G7B.17::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GGCAAGTCGTCTGACATGATT] 3' and primer B 5' [AGTCGACCTGCAGGCATGCAAGCT CCCGCTGGAAAAAGGTTAAT] 3'. | |||
Pattern | Adult Expression: pharynx; anal depressor muscle; unidentified cells in head; | ||||
Larval Expression: pharynx; intestine; unidentified cells in head; | |||||
Remark | Also expressed in (comments from author) : Mosaic population.Embryo incomplete. To be updated.Strain not available. | ||||
Strain: BC10240 | |||||
Reference | WBPaper00006525 | ||||
Transgene | WBTransgene00002150 |