WormBase Tree Display for Expr_pattern: Expr6908
expand all nodes | collapse all nodes | view schema
Expr6908 | Expression_of | Gene | WBGene00004364 | ||
---|---|---|---|---|---|
Reflects_endogenous_expression_of | WBGene00004364 | ||||
Homol | Homol_homol | Y22F5A:Expr | |||
Expression_data | Life_stage (2) | ||||
Anatomy_term | WBbt:0005300 | ||||
WBbt:0005735 | |||||
WBbt:0005739 | Partial | ||||
Remark | unidentified cells | ||||
WBbt:0006751 | |||||
Type | Reporter_gene | [Y22F5A.3::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AGTTGACCAAAACGTAACTTTTCA] 3' and primer B 5' [ATTATTGCTTGTTGTCTGACCGT] 3'. | |||
Pattern | Adult Expression: Nervous System; ventral nerve cord; head neurons; unidentified cells in head; | ||||
Larval Expression: Nervous System; ventral nerve cord; head neurons; unidentified cells in head; | |||||
Remark | Also expressed in (comments from author) : Embryo incomplete. To be updated. | ||||
Strain: BC13241 | |||||
Reference | WBPaper00006525 | ||||
Transgene | WBTransgene00003110 |