Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr6909

expand all nodes | collapse all nodes | view schema

Name Class

Expr6909Expression_ofGeneWBGene00004419
Reflects_endogenous_expression_ofWBGene00004419
HomolHomol_homolY24D9A:Expr
Expression_data (2)
TypeReporter_gene[rpa-7A::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CAAATAAATATGAAAATGCAGCAA] 3' and primer B 5' [CTTGTATGGACGACGGGC] 3'.
PatternAdult Expression: pharynx; intestine; anal depressor muscle; rectal epithelium; Reproductive System; vulva other; body wall muscle; hypodermis; seam cells; excretory cell; Nervous System; ventral nerve cord; head neurons; tail neurons;
Larval Expression: pharynx; intestine; anal depressor muscle; rectal epithelium; Reproductive System; developing vulva; body wall muscle; hypodermis; seam cells; excretory cell; Nervous System; ventral nerve cord; head neurons; tail neurons;
RemarkStrain: BC15215
ReferenceWBPaper00006525
TransgeneWBTransgene00003886