Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr7014

expand all nodes | collapse all nodes | view schema

Name Class

Expr7014Expression_ofGeneWBGene00021698
Reflects_endogenous_expression_ofWBGene00021698
HomolHomol_homolY48G9A:Expr
Expression_dataLife_stage (2)
Anatomy_term (14)
TypeReporter_gene[Y48G9A.4::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CCGTTCCGCTCTTTCTCTC] 3' and primer B 5' [GAACACTCGCGACTTTGAATTAC] 3'.
PatternAdult Expression: pharyngeal gland cells; intestine; Reproductive System; uterine muscle; vulval muscle; gonad sheath cells; body wall muscle; hypodermis; seam cells; Nervous System; ventral nerve cord; head neurons; pharyngeal neurons; neurons along body;
Larval Expression: intestine; body wall muscle; hypodermis; Nervous System; ventral nerve cord; head neurons; pharyngeal neurons; neurons along body;
RemarkStrain: BC14123
ReferenceWBPaper00006525
TransgeneWBTransgene00003411