Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr7015

expand all nodes | collapse all nodes | view schema

Name Class

Expr7015Expression_ofGeneWBGene00004088
Reflects_endogenous_expression_ofWBGene00004088
HomolHomol_homolY48G9A:Expr
Expression_dataLife_stageWBls:0000041
WBls:0000023
Anatomy_term (23)
TypeReporter_gene[ppk-2::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TGATTTTTGGTACTTTTCCGCT] 3' and primer B 5' [TTTTTGTCGAGATGCCGAG] 3'.
PatternAdult Expression: pharynx; intestine; rectal gland cells; stomato-intestinal muscle; anal depressor muscle; rectal epithelium; Reproductive System; distal tip cell; vulval muscle; body wall muscle; excretory cell; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; lateral nerve cords; head neurons; neurons along body; tail neurons;
Larval Expression: pharynx; intestine; rectal gland cells; stomato-intestinal muscle; anal depressor muscle; rectal epithelium; Reproductive System; distal tip cell; developing vulva; developing uterus; body wall muscle; excretory cell; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; lateral nerve cords; head neurons; neurons along body; tail neurons;
Picture (9)
RemarkStrain: BC15528
ReferenceWBPaper00006525
TransgeneWBTransgene00004005