Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr7028

expand all nodes | collapse all nodes | view schema

Name Class

Expr7028Expression_ofGeneWBGene00013111
Reflects_endogenous_expression_ofWBGene00013111
HomolHomol_homolY51H4A:Expr
Expression_data (2)
TypeReporter_gene[Y51H4A.17::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CTTTTTCTACGTGTACGTCAGGG] 3' and primer B 5' [CGATGAGCCCATGATGTCT] 3'.
PatternAdult Expression: pharynx; anal depressor muscle; body wall muscle; Nervous System; nerve ring; tail neurons; unidentified cells in head;
Larval Expression: pharynx; intestine; anal depressor muscle; body wall muscle; Nervous System; nerve ring; tail neurons; unidentified cells in head;
RemarkAlso expressed in (comments from author) : Mosaic population.
Strain: BC11412
ReferenceWBPaper00006525
TransgeneWBTransgene00002584