WormBase Tree Display for Expr_pattern: Expr7053
expand all nodes | collapse all nodes | view schema
Expr7053 | Expression_of | Gene | WBGene00003008 |
---|---|---|---|
Reflects_endogenous_expression_of | WBGene00003008 | ||
Homol | Homol_homol | Y54G2A:Expr | |
Expression_data | Life_stage | WBls:0000041 | |
WBls:0000023 | |||
Anatomy_term (6) | |||
Type | Reporter_gene | [Y54G2A.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTCGATGGTTTTGGAAAGAGTT] 3' and primer B 5' [ATCGATCAGTTGGGATTTATGG] 3'. | |
Pattern | Adult Expression: unidentified cells in body ; | ||
Larval Expression: pharynx; developing uterus; hypodermis; Nervous System; head neurons; | |||
Picture | WBPicture0000006914 | ||
WBPicture0000006915 | |||
Remark | Also expressed in (comments from author) : Observation in Apr vs Oct 2005: Apr is posted and was low intensity GFP. In Oct, nothing but the proximal tip of the gonad expressed GFP. | ||
Strain: BC14240 | |||
Reference | WBPaper00006525 | ||
Transgene | WBTransgene00004236 |