Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr7053

expand all nodes | collapse all nodes | view schema

Name Class

Expr7053Expression_ofGeneWBGene00003008
Reflects_endogenous_expression_ofWBGene00003008
HomolHomol_homolY54G2A:Expr
Expression_data (2)
TypeReporter_gene[Y54G2A.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTCGATGGTTTTGGAAAGAGTT] 3' and primer B 5' [ATCGATCAGTTGGGATTTATGG] 3'.
PatternAdult Expression: unidentified cells in body ;
Larval Expression: pharynx; developing uterus; hypodermis; Nervous System; head neurons;
Picture (2)
RemarkAlso expressed in (comments from author) : Observation in Apr vs Oct 2005: Apr is posted and was low intensity GFP. In Oct, nothing but the proximal tip of the gonad expressed GFP.
Strain: BC14240
ReferenceWBPaper00006525
TransgeneWBTransgene00004236