WormBase Tree Display for Expr_pattern: Expr7095

Expr7095 Expression_of: Gene: WBGene00013460
    Reflects_endogenous_expression_of: WBGene00013460
  Homol: Homol_homol: Y67H2A:Expr
  Expression_data: Life_stage: WBls:0000041
      WBls:0000023
    Anatomy_term: WBbt:0005741 Partial
        Remark: unidentified cells
      WBbt:0005772
      WBbt:0005812
      WBbt:0006756
  Type: Reporter_gene: [Y67H2A.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AAAAATTCAGTTCTTTCCAAGTTT] 3' and primer B 5' [CGCCTTCCTCTTCCATATTCT] 3'.
  Pattern: Adult Expression: intestine; spermatheca uterine valve; excretory cell; unidentified cells in tail ;
    Larval Expression: intestine; excretory cell; unidentified cells in tail ;
  Remark: Also expressed in (comments from author) : Embryo incomplete. To be updated.
    Strain: BC10804
  Reference: WBPaper00006525
  Transgene: WBTransgene00002395