Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr7104

expand all nodes | collapse all nodes | view schema

Name Class

Expr7104Expression_of (2)
HomolHomol_homolCHROMOSOME_V:Expr
Expression_dataLife_stageWBls:0000041
WBls:0000023
Anatomy_term (18)
TypeReporter_gene[nhr-112::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTTGGAAAACGATTAGGTGATTT] 3' and primer B 5' [GCAGATTTTGCAGATTTTGAGA] 3'.
PatternAdult Expression: pharynx; pharyngeal gland cells; intestine; rectal epithelium; Reproductive System; distal tip cell; uterus; vulva other; spermatheca uterine valve; hypodermis; excretory gland cells; Nervous System; head neurons; tail neurons; unidentified cells in head; unidentified cells in body ;unidentified cells in tail ;
Larval Expression: pharynx; pharyngeal gland cells; intestine; rectal epithelium; Reproductive System; distal tip cell; developing vulva; developing uterus; hypodermis; excretory gland cells; Nervous System; head neurons; tail neurons; unidentified cells in head; unidentified cells in body ;unidentified cells in tail ;
RemarkStrain: BC14299
ReferenceWBPaper00006525
TransgeneWBTransgene00003493