WormBase Tree Display for Expr_pattern: Expr7121
expand all nodes | collapse all nodes | view schema
Expr7121 | Expression_of | Gene | WBGene00013529 | ||
---|---|---|---|---|---|
Reflects_endogenous_expression_of | WBGene00013529 | ||||
Homol | Homol_homol | Y73F8A:Expr | |||
Expression_data | Life_stage | WBls:0000041 | |||
WBls:0000023 | |||||
Anatomy_term | WBbt:0003679 | ||||
WBbt:0005300 | |||||
WBbt:0005735 | |||||
WBbt:0005739 | Partial | ||||
Remark | unidentified cells | ||||
WBbt:0005741 | Partial | ||||
Remark | unidentified cells | ||||
WBbt:0005772 | |||||
WBbt:0006751 | |||||
Type | Reporter_gene | [Y73F8A.24::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [AATCTCACGGGCTTTGCTT] 3' and primer B 5' [CGGATGAGATCTGGAAAAACA] 3'. | |||
Pattern (2) | |||||
Remark | Also expressed in (comments from author) : Embryo incomplete. To be updated. | ||||
Strain: BC11661 | |||||
Reference | WBPaper00006525 | ||||
Transgene | WBTransgene00002650 |