Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr7163

expand all nodes | collapse all nodes | view schema

Name Class

Expr7163Expression_ofGeneWBGene00013876
Reflects_endogenous_expression_ofWBGene00013876
HomolHomol_homolZC376:Expr
Expression_data (2)
TypeReporter_gene[ZC376.4::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GTGTATTCAAATGAAAGCACACT] 3' and primer B 5' [GAGCAATATCAACAAAAACAGAA] 3'.
PatternAdult Expression: Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons;
Larval Expression: Reproductive System; developing vulva; developing uterus; head mesodermal cell; hypodermis; Nervous System; nerve ring; ventral nerve cord; head neurons; pharyngeal neurons; tail neurons;
RemarkStrain: BC15162
ReferenceWBPaper00006525
TransgeneWBTransgene00003872