Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr7172

expand all nodes | collapse all nodes | view schema

Name Class

Expr7172Expression_ofGeneWBGene00013919
Reflects_endogenous_expression_ofWBGene00013919
HomolHomol_homolCHROMOSOME_X:Expr
Expression_data (2)
TypeReporter_gene[ZC506.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [CGATGAATTGAATAACAATTTCCA] 3' and primer B 5' [TTTGTGGAAATAAAGCGGAAGT] 3'.
PatternAdult Expression: pharynx; body wall muscle; Nervous System; ventral nerve cord; head neurons; unidentified cells in tail ;
Larval Expression: pharynx; anal depressor muscle; body wall muscle; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons; unidentified cells in tail ;
RemarkStrain: BC10873
ReferenceWBPaper00006525
TransgeneWBTransgene00002408