WormBase Tree Display for Expr_pattern: Expr7175
expand all nodes | collapse all nodes | view schema
Expr7175 | Expression_of | Gene | WBGene00004352 |
---|---|---|---|
Reflects_endogenous_expression_of | WBGene00004352 | ||
Homol | Homol_homol | ZC53:Expr | |
Expression_data | Life_stage | WBls:0000041 | |
WBls:0000023 | |||
Anatomy_term | WBbt:0003679 | ||
WBbt:0005237 | |||
WBbt:0005300 | |||
WBbt:0005733 | |||
WBbt:0005735 | |||
WBbt:0005772 | |||
WBbt:0005799 | |||
WBbt:0006751 | |||
WBbt:0006759 | |||
Type | Reporter_gene | [ZC53.7::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GCTTACTAGCAAACCCGTGC] 3' and primer B 5' [GTGTGAACGATTTTGAAGAGAATG] 3'. | |
Pattern | Adult Expression: intestine; rectal gland cells; Nervous System; ventral nerve cord; head neurons; mechanosensory neurons; neurons along body; tail neurons; | ||
Larval Expression: intestine; rectal gland cells; hypodermis; Nervous System; ventral nerve cord; head neurons; mechanosensory neurons; neurons along body; tail neurons; | |||
Picture | WBPicture0000007073 | ||
WBPicture0000007074 | |||
Remark | Also expressed in (comments from author) : head neurons are mechanosensory, possibly the CEP sensilla.Mosaic population.Embryo incomplete. To be updated. | ||
Strain: BC11487 | |||
Reference | WBPaper00006525 | ||
Transgene | WBTransgene00004396 |