WormBase Tree Display for Expr_pattern: Expr7187

Expr7187 Expression_of: Gene: WBGene00003559 Inferred_automatically
    Reflects_endogenous_expression_of: WBGene00003559
  Homol: Homol_homol: ZK112:Expr
  Expression_data: Life_stage: WBls:0000041
      WBls:0000023
    Anatomy_term: WBbt:0004292
      WBbt:0005739 Partial
        Remark: unidentified cells
  Type: Reporter_gene: [ZK112.3::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TAGGCGAGAAAAATAAGAAGGCT] 3' and primer B 5' [ACGGTAGATTTGGATTTGGTATGT] 3'.
  Pattern: Adult Expression: anal depressor muscle; unidentified cells in head;
    Larval Expression: anal depressor muscle; unidentified cells in head;
  Remark: Strain: BC12631
  Reference: WBPaper00006525
  Transgene: WBTransgene00002983
  Historical_gene: WBGene00022659 Note: This object originally referred to WBGene00022659. WBGene00022659 is now considered dead and has been merged into WBGene00003559. WBGene00003559 has replaced WBGene00022659 accordingly.