WormBase Tree Display for Expr_pattern: Expr7191
expand all nodes | collapse all nodes | view schema
Expr7191 | Expression_of | Gene | WBGene00044072 |
---|---|---|---|
Reflects_endogenous_expression_of | WBGene00044072 | ||
Homol | Homol_homol | ZK1128:Expr | |
Expression_data | Life_stage | WBls:0000041 | |
WBls:0000023 | |||
Anatomy_term (15) | |||
Type | Reporter_gene | [ZK1128.5::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TTCAAAGCTTCTAGTTTTCGACG] 3' and primer B 5' [CGCGCTTGAGTTTGGATT] 3'. | |
Pattern | Adult Expression: pharynx; intestine; Reproductive System; vulval muscle; vulva other; spermatheca; body wall muscle; hypodermis; excretory cell; Nervous System; nerve ring; ventral nerve cord; head neurons; neurons along body; tail neurons; | ||
Larval Expression: pharynx; intestine; Reproductive System; developing vulva; body wall muscle; hypodermis; excretory cell; Nervous System; nerve ring; ventral nerve cord; head neurons; neurons along body; tail neurons; | |||
Remark | Also expressed in (comments from author) : Mosaic population and mosaic tissues. | ||
Strain: BC14556 | |||
Reference | WBPaper00006525 | ||
Transgene | WBTransgene00003603 |