Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr7197

expand all nodes | collapse all nodes | view schema

Name Class

Expr7197Expression_of (2)
HomolHomol_homolZK177:Expr
Expression_dataLife_stageWBls:0000041
WBls:0000023
Anatomy_term (17)
TypeReporter_gene[ZK177.8a::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GTTATCACAGAATGTTCGGCACT] 3' and primer B 5' [GCTTTGCCAGTTGATATTGC] 3'.
PatternAdult Expression: pharynx; stomato-intestinal muscle; Reproductive System; vulval muscle; gonad sheath cells; body wall muscle; hypodermis; seam cells; Nervous System; nerve ring; ventral nerve cord; head neurons; unidentified cells in head; unidentified cells in body ;unidentified cells in tail ;
Larval Expression: pharynx; intestine; body wall muscle; hypodermis; seam cells; Nervous System; nerve ring; ventral nerve cord; head neurons; unidentified cells in head; unidentified cells in tail ;
RemarkStrain: BC10675
ReferenceWBPaper00006525
TransgeneWBTransgene00004232