Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr7202

expand all nodes | collapse all nodes | view schema

Name Class

Expr7202Expression_ofGeneWBGene00013962
Reflects_endogenous_expression_ofWBGene00013962
HomolHomol_homolZK287:Expr
Expression_data (2)
TypeReporter_gene[ZK287.1::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [TGAGTCGTCGTGATCTCCAG] 3' and primer B 5' [TCTCGCTCGTCTCACGTCT] 3'.
PatternAdult Expression: intestine; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; head neurons; tail neurons; unidentified cells; unidentified cells in tail ;
Larval Expression: intestine; Nervous System; nerve ring; ventral nerve cord; dorsal nerve cord; head neurons; tail neurons; unidentified cells; unidentified cells in tail ;
RemarkAlso expressed in (comments from author) : No comment.
Strain: BC11610
ReferenceWBPaper00006525
TransgeneWBTransgene00002636