Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Expr_pattern: Expr7238

expand all nodes | collapse all nodes | view schema

Name Class

Expr7238Expression_ofGeneWBGene00004918
Reflects_endogenous_expression_ofWBGene00004918
HomolHomol_homolZK652:Expr
Expression_dataLife_stageWBls:0000041
WBls:0000023
Anatomy_term (21)
TypeReporter_gene[snr-5::gfp] transcriptional fusion. PCR products were amplified using primer A: 5' [GTGTCTCACCACATCGTTAGTAGG] 3' and primer B 5' [TGAACTGCGGAGATTTCTGA] 3'.
PatternAdult Expression: pharynx; pharyngeal-intestinal valve; intestine; stomato-intestinal muscle; anal depressor muscle; rectal epithelium; Reproductive System; vulva other; body wall muscle; hypodermis; seam cells; excretory cell; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons;
Larval Expression: pharynx; pharyngeal-intestinal valve; intestine; stomato-intestinal muscle; anal depressor muscle; rectal epithelium; Reproductive System; distal tip cell; developing vulva; developing uterus; body wall muscle; hypodermis; seam cells; excretory cell; Nervous System; nerve ring; ventral nerve cord; head neurons; tail neurons;
Picture (7)
RemarkAlso expressed in (comments from author) : No comments.
Strain: BC16083
ReferenceWBPaper00006525
TransgeneWBTransgene00004163