WormBase Tree Display for Expr_pattern: Expr9062
expand all nodes | collapse all nodes | view schema
| Expr9062 | Expression_of | Gene | WBGene00018827 | |
|---|---|---|---|---|
| Reflects_endogenous_expression_of | WBGene00018827 | |||
| Expression_data | Anatomy_term | WBbt:0005772 | Certain | |
| WBbt:0005788 | Certain | |||
| Type | Reporter_gene | |||
| Pattern | In transgenic animals that carried the Ppst-2a::egfp and pst-2a(fl)::egfp constructs, EGFP 2a fluorescence was specifically observed in intestinal and pharyngeal gland cells. | |||
| Picture | WBPicture0000008363 | |||
| WBPicture0000008366 | ||||
| Remark | No GFP signal was observed in worms carrying Ppst-2b::egfp (translational fusion, forward primer 5- TTGACTCCTTTATTTGCCTGAAA 3, reverse primer 5- CATTGTTGCTACTGTGAAAAAGG 3). This suggested that the pst-2b promoter does not have inherent activity. | |||
| Picture: Fig 6E, 6F. | ||||
| Reference | WBPaper00036358 | |||
| Transgene | WBTransgene00030881 |
