WormBase Tree Display for Sequence: T05D4

T05D4 DNA: T05D4 32612
  SMap: S_child (11)
  Structure: From: Source: CHROMOSOME_III
    Overlap_right: Y76A2C 32510
    Overlap_left: Y76A2B
    Clone_left_end: T05D4 1
    Clone_right_end: T05D4 32612
  DB_info: Database: EMBL NDB_AC Z81115
        NDB_SV Z81115.1
    Keyword: HTG
    EMBL_dump_info: EMBL_dump_method: worm_EMBL-dump
  Origin: From_author: McMurray AA
    From_laboratory: HX
    Date_directory: 960812
    Species: Caenorhabditis elegans
    Strain: WBStrain00000001
  Visible: Clone: T05D4
  Properties: Genomic_canonical
    Checksum: MD5: f325197def29955d67a8aaa3b298939e
    Status: Finished: 12 Aug 1996 00:00:00
      Submitted: 21 Oct 1996 00:00:00
      Annotated: 01 Jan 1980 00:00:00
  Map: Sequence-III Ends: Left: 6727
        Right: 6742
  Interpolated_map_position: III 21.2704
  Assembly_tags: Finished Left 1 4 T05D4
    Clone left end 1 4 T05D4 - this could be the right hand end as there is no overlap info (27-7-96)
    annotation 22531 22533 probably TTAT
      30172 32612 tandem repeat, not fully finished predominant element 34mer eg TTTTTCCGCAAGTACATTTTTCCGCCGGTTTGAG length to end of cosmid ~3160 by restriction digest
    Clone right end 32609 32612 T05D4 - this could be the left end as there is no overlap data (27-7-96).
    Finished Right 32609 32612 T05D4
  Method: Genomic_canonical