WormBase Tree Display for Antibody: WBAntibody00000716
expand all nodes | collapse all nodes | view schema
| WBAntibody00000716 | Summary | Rabbit polyclonal antibody against DLG-1 recombinant protein. | ||
|---|---|---|---|---|
| Public_name | [cgc6400]::anti-DLG-1_b | |||
| Gene | WBGene00001006 | |||
| Isolation | Original_publication | WBPaper00006400 | ||
| Clonality | Polyclonal | |||
| Antigen | Protein | A bacterial 6xHis fusion expression construct was made by cloning a 1.17 kb fragment, corresponding amino acids 204593 (PDZ domain 13 of DLG-1), into the BamHI and KpnI sites of the pQE-30 vector (Qiagen). This fragment was generated by PCR of the yk435h12 cDNA (EMBL accession number AJ295228) using oligonucleotides containing a BamHI site (5Vprimer: AGGGATCC GTCTTGGAGAAAGGTCAC) and a KpnI site (3Vprimer: ATGGTACCCTCTTGTGGTCTGTACTG). The fusion protein was expressed in E. coli strain M15 (pREP4), purified using Ni-NTA agarose columns (Qiagen) and injected into one rabbit by Eurogentec. | ||
| Animal | Rabbit | |||
| Expr_pattern | Expr2876 | |||
| Reference | WBPaper00006400 | |||
| WBPaper00033146 | ||||
| WBPaper00035600 | ||||
| WBPaper00040999 | ||||
| WBPaper00039902 | ||||
| WBPaper00045995 |
