WormBase Tree Display for Antibody: WBAntibody00002052
expand all nodes | collapse all nodes | view schema
| WBAntibody00002052 | Summary | Rabbit polyclonal antibody against ZEN-4 recombinant protein. | ||
|---|---|---|---|---|
| Public_name | [WBPaper00035434]:zen-4 | |||
| Gene | WBGene00006974 | |||
| Isolation | Original_publication | WBPaper00035434 | ||
| Clonality | Polyclonal | |||
| Antigen | Protein | Antibodies against the C-terminal 108 amino acids of ZEN-4 were generated by using the primers (cgcgaattccaacagggttacgttaatccaaaat and cgcttccgtcgacttactttcgtgtgctcggagat) to amplify the corresponding region from a gene specific cDNA. | ||
| Animal | Rabbit | |||
| Reference | WBPaper00035434 | |||
| WBPaper00049397 |
