WormBase Tree Display for Construct: WBCnstr00009151
expand all nodes | collapse all nodes | view schema
WBCnstr00009151 | Summary | [unc-54::UNC-45(UCS(-))-FLAG] | |
---|---|---|---|
Driven_by_gene | WBGene00006789 | ||
Gene | WBGene00006781 | ||
Other_reporter | FLAG | ||
Construction_summary | This construct is deleted for the UCS region of UNC-45 is cloned from amino acids 1-523 using primers 5' CGGGGTACCCCGATGGTTGCTCGAGTACAGACT 3' and 5' CGGGGTACCCCGTCACTTGTCATCGTCGTCCTTGTAGTCGGATCCTTCTTCTTTCATCGTTGC 3'. | ||
Used_for | Transgene_construct | WBTransgene00009470 | |
Reference | WBPaper00040187 |