WormBase Tree Display for Construct: WBCnstr00009845
expand all nodes | collapse all nodes | view schema
| WBCnstr00009845 | Public_name | TU#1098 | |
|---|---|---|---|
| Summary | [unc-119p::alr-1] | ||
| Driven_by_gene | WBGene00006843 | ||
| Gene | WBGene00044330 | ||
| Construction_summary | Clone = TU#1098. This plasmid was generated in two steps; first a HindIII/BamHI unc-119p fragment was inserted in the pBS-SK vector, and then a 4,516-bp alr-1 genomic fragment (from ATG to +1 kb downstream, primers: GGCATGCGGCCGCATGCCCGAGTTGAAGAAAGAAGAC and TGGGCGCGGCCGCTGCCCAATGGAGCTGATTTGAATCAG) was inserted at the NotI site of the first construct. | ||
| Used_for | Transgene_construct | WBTransgene00010202 | |
| Reference | WBPaper00040420 |
