WormBase Tree Display for Construct: WBCnstr00012006
expand all nodes | collapse all nodes | view schema
WBCnstr00012006 | Other_name | Expr4442_Ex | |
---|---|---|---|
Summary | [mom-5::gfp] | ||
Driven_by_gene | WBGene00003397 | ||
Fusion_reporter | GFP | ||
Type_of_construct | Transcriptional_fusion | ||
Construction_summary | [mom-5::gfp] transcriptional fusion. Primer A* (5' GCATGCATGCGTCGTAAATCCGCAAGCAC 3') and Primer B (5' GCGGGATCCGATGAGAGTCGTTGATCAGC 3') were used to generate a 3432 bp promoter fragment. --precise ends. | ||
Used_for | Transgene_construct | WBTransgene00029219 | |
Reference | WBPaper00028754 |