WormBase Tree Display for Construct: WBCnstr00013549
expand all nodes | collapse all nodes | view schema
| WBCnstr00013549 | Other_name | Expr8836_Ex | |
|---|---|---|---|
| Summary | [unc-82::UNC-82::GFP] | ||
| Driven_by_gene | WBGene00006814 | ||
| Gene | WBGene00006814 | ||
| Fusion_reporter | GFP | ||
| Type_of_construct | Translational_fusion | ||
| Construction_summary | [unc-82::UNC-82::GFP] translational fusion. A full-length UNC-82::GFP fusion construct was generated by recombination in vivo between a 17 kb PCR fragment and a plasmid encoding the C-terminus of UNC-82 fused to GFP following the method of Yuan et al. (2000). Oligonucleotides GTCTCTGCTAAACAGCAATCG and GTTTGTGTACTTGTTGTGTGTG were used with cosmid template B0496 and the Expand Long Template PCR System (Roche) to amplify a genomic fragment beginning 2.6 kb upstream of the UNC-82 initiator methionine and terminating within intron 27. To fuse the C-terminus of UNC-82 to GFP, primers gacacaagctTCGTTTCCGTCCAACTGCTCG and ccccggatccccATAAATATTTGGATCATCAT were used to amplify a 2 kb genomic fragment spanning exons 24-30, which was cut with HinDIII and BamHI and cloned into pPD95_67. Prior to injection, the plasmid was cut with HinDIII, extracted with phenol/chloroform, and ethanol precipitated. --precise ends. | ||
| Clone | B0496 | ||
| Used_for | Transgene_construct | WBTransgene00030740 | |
| Reference | WBPaper00035423 |
