WormBase Tree Display for Construct: WBCnstr00014267
expand all nodes | collapse all nodes | view schema
| WBCnstr00014267 | Public_name | fUL#JW162 | |
|---|---|---|---|
| Other_name | Expr9747_Ex | ||
| Summary | [F33H1.1::GFP; pRF4] | ||
| Driven_by_gene | WBGene00000914 | ||
| Fusion_reporter | GFP | ||
| Type_of_construct | Transcriptional_fusion | ||
| Construction_summary | Clone = fUL#JW162. The reporter gene fusion assayed was made by recombineering WRM0622dH09. Sequence of homology arms on primers used to direct site of reporter insertion during recombineering, sequence for upstream of reporter first: agctcacagttgactcgtcatattctcctgagcttaattctcttacaatc, agacttcttcctctaacgaacctgtacatggtattgcactgtggtaggta. gfp was inserted immediately after the daf-19c start codon. Other strains: UL3473, UL3474, UL3480 and UL3493. Another fosmid clone, fUL#JW161, was generated independently and, in transgenic strains UL3399 and UL3406, gave the same expression pattern. pRF4 cotransformants: pick rollers to maintain (not integrated). --precise ends. | ||
| Used_for | Transgene_construct | WBTransgene00031192 | |
| Reference | WBPaper00040230 | ||
| Person | WBPerson266 |
