WormBase Tree Display for Construct: WBCnstr00014316
expand all nodes | collapse all nodes | view schema
| WBCnstr00014316 | Public_name | fUL#JW163 | |
|---|---|---|---|
| Other_name | Expr9796_Ex | ||
| Summary | [F33H1.1::GFP; pRF4] | ||
| Driven_by_gene | WBGene00000914 | ||
| Fusion_reporter | GFP | ||
| Type_of_construct | Transcriptional_fusion | ||
| Construction_summary | Clone = fUL#JW163. The reporter gene fusion assayed was made by recombineering WRM0622dH09. Sequence of homology arms on primers used to direct site of reporter insertion during recombineering, sequence for upstream of reporter first: ccatcacaagcccttctccaactatgaccatcttccatttagcgtcagtg, tctccataggcaactgagctcgagtgcaacgatatctttgtaggatctaa. gfp was inserted immediately after the daf-19d start codon. Upstream primer contains 1 extra adenine at the 3' end of the upstream homology arm, directly upstream of gfp, to shift the translational reading frame and stop any reporter expression arising from other transcripts with upstream exons spliced onto the exon targeted in this fusion. Other strains: UL3204, UL3407, UL3833 and UL3530. pRF4 cotransformants: pick rollers to maintain (not integrated). --precise ends. | ||
| Used_for | Transgene_construct | WBTransgene00031241 | |
| Reference | WBPaper00040230 | ||
| Person | WBPerson266 |
