WormBase Tree Display for Construct: WBCnstr00014345
expand all nodes | collapse all nodes | view schema
| WBCnstr00014345 | Public_name | fUL#HC55 | |
|---|---|---|---|
| Other_name | Expr9825_Ex | ||
| Summary | [T28F12.2::GFP; pRF4] | ||
| Driven_by_gene | WBGene00006796 | ||
| Fusion_reporter | GFP | ||
| Type_of_construct | Transcriptional_fusion | ||
| Construction_summary | Clone = fUL#HC55. The reporter gene fusion assayed was made by recombineering WRM061dC01. Sequence of homology arms on primers used to direct site of reporter insertion during recombineering, sequence for upstream of reporter first: tctttttcaaaatttaatatttctctcttgcaggaacatgagcggcgac, ctggcgctattccacctttaatatacttttttcataataaattctgaatt. This is fUL#HC40,with gfp inserted immediately upstream of the unc-62 stop codon,but with an additional modification to disrupt alternative exon 7a of transcripts unc-62e and unc-62f specifically.(cgtcctcgaagaataaaccgtcgacg was changed to cgtcctcgaagTaataaaccgtcgacg.) pRF4 cotransformant: pick rollers to maintain (not integrated). --precise ends. | ||
| Used_for | Transgene_construct | WBTransgene00031270 | |
| Reference | WBPaper00040230 | ||
| Person | WBPerson266 |
