WormBase Tree Display for Construct: WBCnstr00014365
expand all nodes | collapse all nodes | view schema
| WBCnstr00014365 | Public_name | fUL#HC43 | |
|---|---|---|---|
| Other_name | Expr9845_Ex | ||
| Summary | [T28F12.2::GFP; pRF4] | ||
| Driven_by_gene | WBGene00006796 | ||
| Fusion_reporter | GFP | ||
| Type_of_construct | Transcriptional_fusion | ||
| Construction_summary | Clone = fUL#HC43. The reporter gene fusion assayed was made by recombineering WRM061dC01. Sequence of homology arms on primers used to direct site of reporter insertion during recombineering, sequence for upstream of reporter first: acgaccatcgttcatcttattcagcaaggccccgtgtgtcggcaacgacg, agaggggaaacggaatgaaggagaagaagaagaagaagtaccctctgcgc. gfp was inserted immediately after the start codon of unc-62b/e. This reporter gene fusion was also constructed from WRM069bE03, with less upstream and more downstream genomic DNA (see fUL#HC23). pRF4 cotransformant: pick rollers to maintain (not integrated). --precise ends. | ||
| Used_for | Transgene_construct | WBTransgene00031290 | |
| Reference | WBPaper00040230 | ||
| Person | WBPerson266 |
