Questions, Feedback & Help
Send us an email and we'll get back to you ASAP. Or you can read our Frequently Asked Questions.

WormBase Tree Display for Construct: WBCnstr00014759

expand all nodes | collapse all nodes | view schema

Name Class

WBCnstr00014759Public_namepIM218
Summary[mec-4::unc-104; odr-1::dsRed]
Driven_by_geneWBGene00003168
GeneWBGene00006831
Construction_summaryClone = pIM218. This construct was made by PCR amplifying unc-104 cDNA sequence from a C. elegans cDNA library (Invitrogen, Carlsbad, CA) using primers: forward,GATCGCATCCTAGGATGTCATCGGTTAAAGTAGCTGT and reverse, GATCGCATGGTACCTTATGAAGCAATTGAAGATGATGTT. The PCR product was digested with AvrII and KpnI restriction enzymes and was cloned into the NheI and KpnI sites behind the mec-4 promoter sequence of plasmid pIM207 (Quinn et al. 2006).
Used_forTransgene_constructWBTransgene00015161
ReferenceWBPaper00040041