WormBase Tree Display for Construct: WBCnstr00014759
expand all nodes | collapse all nodes | view schema
WBCnstr00014759 | Public_name | pIM218 | |
---|---|---|---|
Summary | [mec-4::unc-104; odr-1::dsRed] | ||
Driven_by_gene | WBGene00003168 | ||
Gene | WBGene00006831 | ||
Construction_summary | Clone = pIM218. This construct was made by PCR amplifying unc-104 cDNA sequence from a C. elegans cDNA library (Invitrogen, Carlsbad, CA) using primers: forward,GATCGCATCCTAGGATGTCATCGGTTAAAGTAGCTGT and reverse, GATCGCATGGTACCTTATGAAGCAATTGAAGATGATGTT. The PCR product was digested with AvrII and KpnI restriction enzymes and was cloned into the NheI and KpnI sites behind the mec-4 promoter sequence of plasmid pIM207 (Quinn et al. 2006). | ||
Used_for | Transgene_construct | WBTransgene00015161 | |
Reference | WBPaper00040041 |