WormBase Tree Display for Construct: WBCnstr00017240
expand all nodes | collapse all nodes | view schema
WBCnstr00017240 | Summary | [lin-12(mutated LAG-1 binding sites)::YFP] | |
---|---|---|---|
Driven_by_gene | WBGene00003001 | ||
Fusion_reporter | YFP | ||
Type_of_construct | Transcriptional_fusion | ||
Construction_summary | The lin-12(mutated LAG-1 binding sites)::YFP transcriptional fusion construct was prepared by cloning a PCR-amplified genomic DNA fragment into the pPD122.53(YFP) plasmid, which contains NLS4::YFP. The fragment (cgaatactggaaatatgatg --- ttttttqcccaattcccata)contains the 5'upstream region, 1st exon, 1st intron,2nd exon, and part of the 2nd intron of lin-12. The genomic region contains 17 putative LAG-1-binding sites. All 17 candidate binding sites were mutated in this transcriptional fusion construct. | ||
Used_for | Transgene_construct | WBTransgene00017849 | |
Reference | WBPaper00042122 |