WormBase Tree Display for Construct: WBCnstr00021222
expand all nodes | collapse all nodes | view schema
WBCnstr00021222 | Public_name | pCFJ151 him-3(G280K) |
---|---|---|
Summary | him-3(G280K) | |
Gene | WBGene00001862 | |
Construction_summary | For him-3G280K, Q5 site-directed mutagenesis was used to insert a Cas9 targeting sequence for him-3 (CAAACCAATCGAAAAGGAA) into pDD162 (Peft-3::Cas9 + empty sgRNA) (Dickinson et al., 2013). Isothermal assembly with a synthetic gene block containing the G280K mutation and silent mutations in the Cas9 targeting sequence (CAAACCAAAGCAAGCGTAAA) was used to generate a repair template (pCFJ151 him-3G280K). N2 worms were injected with Cas9 + him-3 sg RNA construct (50 ng/l), a repair template (50 ng/l), pCFJ104 (5 ng/l), and pCFJ90 (2.5 ng/l). F1 progeny were lysed and screened for homologous recombination by PCR using a forward primer specific to the endogenous him-3 gene (CCACCGAAATCCACAATTTCTCG) and a reverse primer specific to the mutated him-3 Cas9 targeting sequence on the repair template (GAAATTCGTCCTTTACGCTTGCT). The G280K mutation at the endogenous him-3 locus was verified by sequencing. Both him-8T64A and him-3G280K strains were outcrossed three times before analysis. | |
Reference | WBPaper00048711 |