WormBase Tree Display for RNAi: WBRNAi00001284
expand all nodes | collapse all nodes | view schema
| WBRNAi00001284 | History_name | SA:yk299e12 | |||
|---|---|---|---|---|---|
| Homol | Homol_homol | Y37E3:RNAi | |||
| Sequence_info | DNA_text | cgacccgttcgcagaagccaaacgtcgtggaatctaccatgaagtggactcgggaagtgatatgaccaccgatttgattatcgatcgaatcatccatcaccgtctcgagtatgagacacgaaataagaagaaggagaagaaagaagctgatgtggcaaaagccatgaacttgatttaaatatttctttatttttttaagcatttaatgcctattaatgcctattaatcaatgcttttcaattcaattctagtcgacctaatatttccattttttttctctcccacttgccacttacactt | yk299e12 | ||
| Sequence | yk299e12 | ||||
| Experiment | Laboratory | SA | |||
| YK | |||||
| Date | 06 Feb 2001 00:00:00 | ||||
| Inhibits | Predicted_gene | Y37E3.11d | Inferred_automatically | RNAi_primary | |
| Y37E3.11g | Inferred_automatically | RNAi_primary | |||
| Y37E3.11c | Inferred_automatically | RNAi_primary | |||
| Y37E3.11h | Inferred_automatically | RNAi_primary | |||
| Y37E3.11f | Inferred_automatically | RNAi_primary | |||
| Y37E3.11b | Inferred_automatically | RNAi_primary | |||
| Y37E3.11e | Inferred_automatically | RNAi_primary | |||
| Y37E3.11i | Inferred_automatically | RNAi_primary | |||
| Y37E3.11a | Inferred_automatically | RNAi_primary | |||
| Gene | WBGene00021352 | Inferred_automatically | RNAi_primary | ||
| Transcript | Y37E3.11e.1 | Inferred_automatically | RNAi_primary | ||
| Y37E3.11a.1 | Inferred_automatically | RNAi_primary | |||
| Y37E3.11g.1 | Inferred_automatically | RNAi_primary | |||
| Y37E3.11i.1 | Inferred_automatically | RNAi_primary | |||
| Y37E3.11h.1 | Inferred_automatically | RNAi_primary | |||
| Y37E3.11b.1 | Inferred_automatically | RNAi_primary | |||
| Y37E3.11d.1 | Inferred_automatically | RNAi_primary | |||
| Y37E3.11f.1 | Inferred_automatically | RNAi_primary | |||
| Y37E3.11c.1 | Inferred_automatically | RNAi_primary | |||
| Species | Caenorhabditis elegans | ||||
| Reference | WBPaper00004651 | ||||
| Phenotype_not_observed | WBPhenotype:0000050 | ||||
| WBPhenotype:0000062 | |||||
| WBPhenotype:0000535 | |||||
| WBPhenotype:0000689 | |||||
| WBPhenotype:0000886 | |||||
| Remark | yk299e12 | ||||
| clone does not match to the reported genomic sequence | |||||
| Entire sequence of clone used for RNAi not known as only the ends of the sequence were determined. The only target shown is the best match. | |||||
| Method | RNAi |
