WormBase Tree Display for RNAi: WBRNAi00038576
expand all nodes | collapse all nodes | view schema
| WBRNAi00038576 | Homol | Homol_homol | M01G5:RNAi | ||
|---|---|---|---|---|---|
| Sequence_info | DNA_text | attttattcaaattcatttgtcctatggtatatctggcgattctttgcttcctttggcttgattggaactcaattcaatacgaatcctatcaattcccgtattggtcaattctgacagcatggtgcatcgccagttttccgctaatcctcattccaatcgtcggaatctggcaattttgtatcgctaagggtacaattacccaaaaatggtggagggtactgtacccggacgacgcttggggacccgcgatggcaatacatcgagccgaaaaatttccgctacaaattccagaggcccggaggttgctgctgccgccagaagtcgaaattgccagttcgcggggggttttacag | |||
| Experiment | Laboratory | BZ | |||
| Date | 19 Aug 2004 00:00:00 | ||||
| Strain | WBStrain00000001 | ||||
| Delivered_by | Injection | ||||
| Inhibits | Predicted_gene | M01G5.5 | Inferred_automatically | RNAi_primary | |
| Gene | WBGene00004905 | Inferred_automatically | RNAi_primary | ||
| Transcript | M01G5.5.1 | Inferred_automatically | RNAi_primary | ||
| Species | Caenorhabditis elegans | ||||
| Reference | WBPaper00024304 | ||||
| Phenotype | WBPhenotype:0000643 | ||||
| Remark | During slow basal movements RNAi-treated animals show essentially wild-type locomotory behaviours; however, when animals are forced to move forwards rapidly in response to mechanical stimulation, they exhibit exaggerated bending of the anterior body and head, and mild hypercontraction. | ||||
| Method | RNAi |
