WormBase Tree Display for RNAi: WBRNAi00061062
expand all nodes | collapse all nodes | view schema
| WBRNAi00061062 | Homol | Homol_homol | Y56A3A:RNAi | ||
|---|---|---|---|---|---|
| Sequence_info | DNA_text | atggcttctagtagcagtggtggagcaggtggagcaggtggagcaagtggagcaccagaagtcaagattcacaacgtatatatgtcaaacgtggaggaggaattcgcgaggattcgaggattcgtcgaggattatccctacgtggcaatggacacagaatttcccggagttgtggcgacaccgttgggcacatttcgaagcaaggaagatttcaattatcagcaagtgttctgtaatgtgaatatgctgaaattaatacaagtgggctttgcaatggtcaatgacaaaggagagctaccaccgactggcgatgtttggcagttcaatttcaatttctccttcgctgaagacatgttctcgcatgagagtgtcgaaatgctccggcaagccggaatagacttcacattgctgcagaacaatggaataccgacagcagtattcggagaacttttgacgacgtcaggcctcatcactgatccacggatcacatggctcacgttctcttccggctacgactttggatatttgttgaaaagcatcacacttggagatctgcctaaggaagagtcaacgttcttcatg | |||
| Experiment | Date | 17 May 2005 00:00:00 | |||
| Strain | WBStrain00000001 | ||||
| Delivered_by | Injection | ||||
| Inhibits | Predicted_gene | Y56A3A.20 | Inferred_automatically | RNAi_primary | |
| Gene | WBGene00000369 | Inferred_automatically | RNAi_primary | ||
| Transcript | Y56A3A.20.1 | Inferred_automatically | RNAi_primary | ||
| Species | Caenorhabditis elegans | ||||
| Reference | WBPaper00026675 | ||||
| Phenotype | WBPhenotype:0000050 | ||||
| WBPhenotype:0000054 | |||||
| WBPhenotype:0000583 | |||||
| WBPhenotype:0000689 | Remark | both male and hermaphrodite are sterile with a block in germ cell development at the pachytene stage (meiosis I) | |||
| WBPhenotype:0000697 | |||||
| WBPhenotype:0000749 | Remark | in embryos the daughter cell AB is often not significantly larger than the P1 cell | |||
| WBPhenotype:0000823 | Remark | less germ cells in adult | |||
| Method | RNAi |
