WormBase Tree Display for RNAi: WBRNAi00063928
expand all nodes | collapse all nodes | view schema
| WBRNAi00063928 | Homol | Homol_homol | K03D3:RNAi | ||
|---|---|---|---|---|---|
| Sequence_info | DNA_text | gctccgtgaacgtcggctccaaccagtgagccacacccagggttacgtgatggcaaaggaaatcaaggcggtcaagtacctggaatgctcggcgcttacccaaattggattgaaacaagttttcgatgaggcaattcgtactgggctcaccccgccacaaacaccacaaacgagagccaaaaagagcaattgcacggtgctttaa | |||
| Experiment | Laboratory | LE | |||
| Date | 21 Sep 2005 00:00:00 | ||||
| Genotype | mig-2(mu28) | ||||
| Delivered_by | Injection | ||||
| Inhibits | Predicted_gene | K03D3.10 | Inferred_automatically | RNAi_primary | |
| Gene | WBGene00004287 | Inferred_automatically | RNAi_primary | ||
| Transcript | K03D3.10.1 | Inferred_automatically | RNAi_primary | ||
| Species | Caenorhabditis elegans | ||||
| Reference | WBPaper00026842 | ||||
| Phenotype | WBPhenotype:0001140 | Remark | mig-2(mu28) and rac-2(RNAi) synergize to increase the percentage of neuronal migration defects as assayed in AQR/PQR neurons. | ||
| Remark | osm-6::gfp was used to score AQR and PQR defects | ||||
| Method | RNAi |
