WormBase Tree Display for RNAi: WBRNAi00065136
expand all nodes | collapse all nodes | view schema
WBRNAi00065136 | Homol | Homol_homol | Y51H4A:RNAi | ||
---|---|---|---|---|---|
Sequence_info | DNA_text | atggctgcgattagaaagaagttggtgatcgtcggcgacggagcctgcggtaaaacttgcctgctcatcgttttctcaaaggatcagttcccagacgtgtatgtgccgactgttttcgagaattatgttgccgacattgaagttgacggaaagcaggtcgaacttgctctatgggatacagctggacaagaggactatgatcgtctgcgtccactctcttatccggatactgacgtcattctgatgtgcttctcaattgattcacccgattcactggagaatattccagaaaaatggacaccagaagtcaggcatttctgtccaaatgttccgattattttggtcggaaataaacgagatcttcgtagtgatccacagactgttcgagaattggcaaaaatgaaacaggagcccgtgaagcctgagcagggacgagcaattgctgagcaaattggagcatttgcatatttggagtgctctgcgaagactaaggacggaattcgtgaggtattcgagaaggcgacacaggcggcattgcaacagaagaagaaaaagaagagcaagtgcatgattttgtaa | |||
Experiment | Laboratory | MH | |||
Date | 06 Nov 2001 00:00:00 | ||||
Genotype | unc-47::GFP | ||||
Delivered_by | Injection | ||||
Inhibits | Predicted_gene | Y51H4A.3a | Inferred_automatically | RNAi_primary | |
Gene | WBGene00004357 | Inferred_automatically | RNAi_primary | ||
Transcript | Y51H4A.3b | Inferred_automatically | RNAi_primary | ||
Y51H4A.3a.1 | Inferred_automatically | RNAi_primary | |||
Species | Caenorhabditis elegans | ||||
Reference | WBPaper00004959 | ||||
Phenotype | WBPhenotype:0000905 | Remark | morphology of GABA neurons in the ventral cord aberrant | ||
WBPhenotype:0001312 | Remark | a reduction in the number of GABA neurons in the ventral cord | |||
Remark | scored in rho-1(RNAi) escapers | ||||
Method | RNAi |