WormBase Tree Display for RNAi: WBRNAi00069418
expand all nodes | collapse all nodes | view schema
| WBRNAi00069418 | Homol | Homol_homol | ZK1067:RNAi | ||
|---|---|---|---|---|---|
| Sequence_info | DNA_text | gaaaatcgctgaaatggttgacatgcctgaactaactccaattgatgccagtgttcgaccaaacatgtctagaatttgcctcattccatcatccgagctgcaaaccaaactagacaaaaagctgggagccggagcattcggaactgtctttgctggaatttactatccaaagcgagcaaagaatgttaaaatcccggttgcaatcaaagtattccaaacagatcaaagtcaaactgatgaaatgttggaagaagctacgaatatgttcagattgagacacgataatttgctcaagattattggattctgtatgcacgatgatggtttgaaaattgtcactatctacagacctctcggaaatcttcaaaactttttgaaacttcacaaggaaaatttgggtgcacgagaacaagtattatattgttatcaaattgcatctggaatgcaatatttagagaaacagcgagttgttcacagagatttggcaacaagaaatgttcttgtgaagaagttcaatcacgtggaaatcactgattttggtctctctaaaattctgaaacatgacgccgactcaatcactatcaaatctggaaaagttgcaatcaaatggcttgcgatcgaaatcttctccaaacattgttacacccatgcttctgatgtttgggcatttggagtcacatgttgggagattataacatttggacaaagtccgtatcaaggaatgtcgactgatagtattcataatttcttgaaagatggaaaccgtctttcccagccaccaaactgctctcaagacttgtatcaagagcttctgagatgttggatggcggatccaaagtctcgtcctggttttgaaatattatatgaaagatttaaagaattctgtaaggttccccaacttttcctggaaaattccaacaagatttctgaatctgatttgtcagctgaagaacgttttcaaacggaaagaatccgagaaatgtttgatggaaatatcgatccacagatgtactttgatcaaggaagtttaccaagtatgccaagttct | |||
| Experiment | Laboratory | PS | |||
| Date | 17 Aug 2007 00:00:00 | ||||
| Genotype | hs:LIN-3 | ||||
| Treatment | animals were heat shocked for 30 minutes at 33 C | ||||
| Delivered_by | Bacterial_feeding | ||||
| Inhibits | Predicted_gene | ZK1067.1b | Inferred_automatically | RNAi_primary | |
| ZK1067.1d | Inferred_automatically | RNAi_primary | |||
| ZK1067.1c | Inferred_automatically | RNAi_primary | |||
| ZK1067.1a | Inferred_automatically | RNAi_primary | |||
| Gene | WBGene00002299 | Inferred_automatically | RNAi_primary | ||
| Transcript | ZK1067.1d.1 | Inferred_automatically | RNAi_primary | ||
| ZK1067.1b.1 | Inferred_automatically | RNAi_primary | |||
| ZK1067.1c.1 | Inferred_automatically | RNAi_primary | |||
| ZK1067.1a.1 | Inferred_automatically | RNAi_primary | |||
| Species | Caenorhabditis elegans | ||||
| Reference | WBPaper00031030 | ||||
| Phenotype | WBPhenotype:0001524 | Remark | hs:LIN-3 induces a reversible cessation of pharyngeal pumping (behavioral quiescence) and let-23 RNAi partially suppresses the hs:LIN-3 pumping defect. | ||
| Remark | hs:LIN-3 amimals have a transgene that induces LIN-3 expression via heat shock. hs:LIN-3 = lin-3 cDNA placed under the control of the hsp16-41 promoter. | ||||
| Method | RNAi |
