WormBase Tree Display for RNAi: WBRNAi00075710
expand all nodes | collapse all nodes | view schema
| WBRNAi00075710 | Homol | Homol_homol | Y71F9B:RNAi | ||
|---|---|---|---|---|---|
| Sequence_info | DNA_text | gaccagcaattgagccaacacaattggtatacacacgggaaaacgatgaagaatttcaaggatctttactatcaagttttggagaagtcgatgattattatgtaaaaacctcaacaatcggaagaactcgaccacagcctcgcccgaagcgtgagccgaatcagctgacaagtatggatatgatgtctgcagaacttgacaaaagccgtcacaccatggaaggatcaatgcgtgatgctcaaacatcaagcttcctcgacgcggcccgtgtccgaatgaaacaatccattggtgcagctcacgctgttggacttgcaagccatcagccaccagcttctccagtcgcagcagcagcagcagctccaggcggtccgatgaggcataattcatatccgagtggctttgaaccgccgccgtcggtggctccgtatgatttccctgctgatccatcaaagaagcagcggaaacagcgtgccaagaagcagcctggagaagagccgccggctggaaggggtaaaggagggaagaagggacgaggagctggagcagttggagcagcagcggctggtggaaggaaaagtgctggtggagctggagaaaatccgtttgggatggatccgatgaggcctccgatgttgcagaggagctcgagtgaacagc | |||
| Experiment | Laboratory | EM | |||
| Date | 15 Dec 2000 00:00:00 | ||||
| Genotype | pal-1(e2091); him-5(e1490) | ||||
| Temperature | 20 | ||||
| Delivered_by | Injection | ||||
| Inhibits | Predicted_gene | Y71F9B.10c | Inferred_automatically | RNAi_primary | |
| Y71F9B.10b | Inferred_automatically | RNAi_primary | |||
| Y71F9B.10d | Inferred_automatically | RNAi_primary | |||
| Y71F9B.10g | Inferred_automatically | RNAi_primary | |||
| Y71F9B.10e | Inferred_automatically | RNAi_primary | |||
| Y71F9B.10a | Inferred_automatically | RNAi_primary | |||
| Gene | WBGene00004946 | Inferred_automatically | RNAi_primary | ||
| Transcript | Y71F9B.10g.1 | Inferred_automatically | RNAi_primary | ||
| Y71F9B.10d.1 | Inferred_automatically | RNAi_primary | |||
| Y71F9B.10c.1 | Inferred_automatically | RNAi_primary | |||
| Y71F9B.10e.1 | Inferred_automatically | RNAi_primary | |||
| Y71F9B.10b.1 | Inferred_automatically | RNAi_primary | |||
| Y71F9B.10a.1 | Inferred_automatically | RNAi_primary | |||
| Species | Caenorhabditis elegans | ||||
| Interaction | WBInteraction000008558 | ||||
| Reference | WBPaper00004616 | ||||
| Phenotype_not_observed | WBPhenotype:0000199 | Remark | In pal-1(e2091), rays 2-6 of the male tail are absent and replaced by longitudinal cuticular ridges (ectopic posterior alae). This defect is mostly suppressed by sop-3 RNAi as rays are mostly normal but exhibit a low level of defects (for example, sometimes rays are fused). | ||
| WBPhenotype:0001693 | Remark | In pal-1(e2091), rays 2-6 of the male tail are absent and replaced by longitudinal cuticular ridges (ectopic posterior alae). This defect is mostly suppressed by sop-3 RNAi as rays are mostly normal but exhibit a low level of defects (for example, sometimes rays are fused). | |||
| Method | RNAi |
