WormBase Tree Display for RNAi: WBRNAi00077017
expand all nodes | collapse all nodes | view schema
| WBRNAi00077017 | Homol | Homol_homol | W05E7:RNAi | ||
|---|---|---|---|---|---|
| Sequence_info | DNA_text | ggatcagtgttcagctcggcagcgatgaagtttctactccttcttggcgcggttatagccgttcgaggtattttttctggaatttcaacactttcagtacactttcactccgtgatccttttcagcccaatccgacacatgcccatcactcaaggatcgtcagcttgccaagcctggccagctgttctgctgtgatagcaccatcaaaaccgtcgtggagaccggaatgcagaccctggacctcttcggagctggtggaccacaaacacttggaccaatcgttcaggcgctaagcaccttcgttcagcaacacttcaaaactgcctatgagattgttatggctccaaaggactttgtgctcaacacacactacaatggcaccagtctctgcaagttccagtccaacagttacaccttggccatctacgagaccccagctaaagtaagtttattagatttcagagagatccggctaattcttgaatctttcagtacgatatcaacagctccagagaaaagtacttcaacaagttcgctctcaacgacaagctccgtctgccatcagtttccaagcacctcaagcaattctccggacttgccaacaccgccaccggaggactcagtggatccgctggatctgtcgccggcggccttgctggaggattcttcggacgctaagacgttgcaaaatgtgtgcaagtggaaccattgcctgctgtaaaatgaaaaacattacggggatcgtcatctttttgtcgctgaaaccagattttttatgaataaagcatttaaaaatca | |||
| Experiment | Laboratory | PK | |||
| Date | 27 Jun 2005 00:00:00 | ||||
| Delivered_by | Bacterial_feeding | ||||
| Inhibits | Predicted_gene | W05E7.1 | Inferred_automatically | RNAi_primary | |
| Gene | WBGene00001692 | Inferred_automatically | RNAi_primary | ||
| Transcript | W05E7.1.1 | Inferred_automatically | RNAi_primary | ||
| Species | Caenorhabditis elegans | ||||
| Reference | WBPaper00026841 | ||||
| Phenotype | WBPhenotype:0000229 | ||||
| WBPhenotype:0000643 | Remark | animals become immobile | |||
| WBPhenotype:0001395 | Remark | fluid filled vacuoles in intestine and hypodermis | |||
| WBPhenotype:0001428 | |||||
| Remark | exact sequence used for RNAi not stated by authors, genomic sequence of gene used for curation | ||||
| Method | RNAi |
