WormBase Tree Display for RNAi: WBRNAi00077683
expand all nodes | collapse all nodes | view schema
| WBRNAi00077683 | Homol | Homol_homol | F30H5:RNAi | ||
|---|---|---|---|---|---|
| Sequence_info | DNA_text | ccaactacgattctcttctgacactcaccaacttggcaagcgtcagtgattcgattcgtggacgaattttgaaagagaaggcaattccaaagattgaggaattctggtttatgacggatcacgagcatttgagagccgccgccgctgagcttcttctcaatttgctctttttcgagaagttttatgaggaaactgttgcgcccggaaccgatcgtctgaaactctgggttctctactcggcagaagttgaagaggaacgtctatcacgtgcctcggcggcaggtttcgccattcttacagaggacgagaacgcttgtgctaggattatggacgagattaaatcatggcctgaggtgttcaaagacattgcaatgcacgaggatgcggaaacccaacgtcgtggccttatgggaattgcgaatataatgcactcgagcaacaaactgtgctccgaaattgtatcgtccgaagtgttccgtgtcctggtcgccgtcacaaagctcggcactatcaatcaggaacgggcaggctcgacggaacaggcgaaacgtggattggaggccgccgagaagtttggactgattaaggcgacggatcgagagatttatgaacgcgaaaatcaaatgagcaccattcaggaataa | |||
| Experiment | Laboratory | DP | |||
| Date | 21 Nov 2007 00:00:00 | ||||
| Genotype | NMY-2::GFP | ||||
| Delivered_by | Injection | ||||
| Inhibits | Predicted_gene | F30H5.1 | Inferred_automatically | RNAi_primary | |
| Gene | WBGene00006781 | Inferred_automatically | RNAi_primary | ||
| Transcript | F30H5.1.1 | Inferred_automatically | RNAi_primary | ||
| Species | Caenorhabditis elegans | ||||
| Reference | WBPaper00031424 | ||||
| Phenotype | WBPhenotype:0000436 | Remark | NMY-2::GFP did not gather into a contractile anterior domain, instead myosin remained at the cortex and often smaller non-contractile punctae were localized throughout the embryo. | ||
| WBPhenotype:0000777 | Remark | often fails | |||
| WBPhenotype:0001044 | Remark | Reduced cortical granual flow and cortical ruffling was reduced during pronuclear migration. | |||
| WBPhenotype:0001078 | Remark | often fails | |||
| WBPhenotype:0001129 | Remark | Cleavage furrow found at a more central location occurring at 48 percent as opposed to the wild type placement of 42 percent of egg length. | |||
| WBPhenotype:0001155 | Remark | Failed polarity establishment as pronuclei meet centrally. | |||
| WBPhenotype:0001168 | |||||
| Remark | Exact sequence used for RNAi not stated by authors, 644 bp C-termianal portion of spliced coding region sequence used for curation | ||||
| Method | RNAi |
